Skip to main content

psiCHECK2-miR-34 WT
(Plasmid #78258)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78258 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    psiCHECK-2
  • Backbone manufacturer
    Promega
  • Backbone size w/o insert (bp) 6273
  • Total vector size (bp) 6302
  • Vector type
    Mammalian Expression, Luciferase ; microRNA activity

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    fully complimentary miR-34 target site
  • Species
    Synthetic
  • Insert Size (bp)
    29

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site XhoI (not destroyed)
  • 3′ cloning site NotI (not destroyed)
  • 5′ sequencing primer CGTGCTGAAGAACGAGCAGT
  • 3′ sequencing primer CAAACCCCCGCCTCCACGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Please note there is a single nucleotide mismatch between the published miR34 sequence and Addgene's quality control sequence. This mismatch does not affect plasmid function.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    psiCHECK2-miR-34 WT was a gift from Joanne Weidhaas (Addgene plasmid # 78258 ; http://n2t.net/addgene:78258 ; RRID:Addgene_78258)
  • For your References section:

    miR-34 activity is modulated through 5'-end phosphorylation in response to DNA damage. Salzman DW, Nakamura K, Nallur S, Dookwah MT, Metheetrairut C, Slack FJ, Weidhaas JB. Nat Commun. 2016 Mar 21;7:10954. doi: 10.1038/ncomms10954. 10.1038/ncomms10954 PubMed 26996824