Skip to main content

pTpal-fdc
(Plasmid #78288)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78288 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTrc99A
  • Backbone size w/o insert (bp) 4176
  • Total vector size (bp) 7837
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    PAL2
  • Species
    A. thaliana (mustard weed)
  • Insert Size (bp)
    2154
  • Mutation
    *see below
  • Entrez Gene
    PAL2 (a.k.a. AT3G53260, ATPAL2, phenylalanine ammonia-lyase 2)
  • Promoter trc

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site NcoI (not destroyed)
  • 3′ cloning site XbaI (not destroyed)
  • 5′ sequencing primer acacaggaaacagaccatgg
  • 3′ sequencing primer TCTAGATTAGCAAATCGGAA
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    FDC1
  • Species
    S. cerevisiae (budding yeast)
  • Insert Size (bp)
    1512
  • Entrez Gene
    FDC1 (a.k.a. YDR539W)

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site SbfI (not destroyed)
  • 3′ cloning site HindIII (not destroyed)
  • 5′ sequencing primer TCTAGATTAGCAAATCGGAA
  • 3′ sequencing primer CGCCAAAACAGCCAAGCTT
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

*Note: Addgene's quality control sequencing finds an E50A amino acid residue substitution in the A. thaliana PAL2 gene insert. The depositing laboratory does not believe this residue change will affect protein function. This plasmid accurately reflects the construct as it was used in the associated publication.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTpal-fdc was a gift from David Nielsen (Addgene plasmid # 78288 ; http://n2t.net/addgene:78288 ; RRID:Addgene_78288)
  • For your References section:

    Microbial production of the aromatic building-blocks (S)-styrene oxide and (R)-1,2-phenylethanediol from renewable resources. McKenna R, Pugh S, Thompson B, Nielsen DR. Biotechnol J. 2013 Dec;8(12):1465-75. doi: 10.1002/biot.201300035. Epub 2013 Jul 29. 10.1002/biot.201300035 PubMed 23801570