pTpal-fdc
(Plasmid
#78288)
-
PurposeExpresses A. thaliana PAL2 and S. cerevisiae FDC1 in E. coli
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78288 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepTrc99A
- Backbone size w/o insert (bp) 4176
- Total vector size (bp) 7837
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namePAL2
-
SpeciesA. thaliana (mustard weed)
-
Insert Size (bp)2154
-
Mutation*see below
-
Entrez GenePAL2 (a.k.a. AT3G53260, ATPAL2, phenylalanine ammonia-lyase 2)
- Promoter trc
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site NcoI (not destroyed)
- 3′ cloning site XbaI (not destroyed)
- 5′ sequencing primer acacaggaaacagaccatgg
- 3′ sequencing primer TCTAGATTAGCAAATCGGAA
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameFDC1
-
SpeciesS. cerevisiae (budding yeast)
-
Insert Size (bp)1512
-
Entrez GeneFDC1 (a.k.a. YDR539W)
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site SbfI (not destroyed)
- 3′ cloning site HindIII (not destroyed)
- 5′ sequencing primer TCTAGATTAGCAAATCGGAA
- 3′ sequencing primer CGCCAAAACAGCCAAGCTT
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
*Note: Addgene's quality control sequencing finds an E50A amino acid residue substitution in the A. thaliana PAL2 gene insert. The depositing laboratory does not believe this residue change will affect protein function. This plasmid accurately reflects the construct as it was used in the associated publication.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTpal-fdc was a gift from David Nielsen (Addgene plasmid # 78288 ; http://n2t.net/addgene:78288 ; RRID:Addgene_78288) -
For your References section:
Microbial production of the aromatic building-blocks (S)-styrene oxide and (R)-1,2-phenylethanediol from renewable resources. McKenna R, Pugh S, Thompson B, Nielsen DR. Biotechnol J. 2013 Dec;8(12):1465-75. doi: 10.1002/biot.201300035. Epub 2013 Jul 29. 10.1002/biot.201300035 PubMed 23801570