Skip to main content

AgDD
(Plasmid #78289)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78289 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    PiggyBac transformation vector pB
  • Backbone size w/o insert (bp) 6652
  • Total vector size (bp) 7739
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NES-L106P-sfGFP
  • Alt name
    AgDD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1087
  • GenBank ID
    NM_000801 AB971579
  • Entrez Gene
    FKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
  • Promoter pCAG
  • Tag / Fusion Protein
    • MLALKLAGLDI (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer YM213--5' atgccttcttctttttcctacagct
  • 3′ sequencing primer YM215--5' gatgagtttggacaaaccacaact
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AgDD was a gift from Thomas Wandless (Addgene plasmid # 78289 ; http://n2t.net/addgene:78289 ; RRID:Addgene_78289)
  • For your References section:

    A method to rapidly create protein aggregates in living cells. Miyazaki Y, Mizumoto K, Dey G, Kudo T, Perrino J, Chen LC, Meyer T, Wandless TJ. Nat Commun. 2016 May 27;7:11689. doi: 10.1038/ncomms11689. 10.1038/ncomms11689 PubMed 27229621