Skip to main content
Addgene
Open Menu

AgDD
(Plasmid #78289)

Print

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78289 Standard format: Plasmid sent in bacteria as agar stab 1 $94
Add to Cart
DNA 78289-D50 50 μg of DNA in Tris buffer $495
Add to Cart
DNA 78289-D100 100 μg of DNA in Tris buffer $585
Add to Cart

Backbone

  • Vector backbone
    PiggyBac transformation vector pB
  • Backbone size w/o insert (bp) 6652
  • Total vector size (bp) 7739
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    NES-L106P-sfGFP
  • Alt name
    AgDD
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1087
  • GenBank ID
    NM_000801 AB971579
  • Entrez Gene
    FKBP1A (a.k.a. FKBP-12, FKBP-1A, FKBP1, FKBP12, PKC12, PKCI2, PPIASE)
  • Promoter pCAG
  • Tag / Fusion Protein
    • MLALKLAGLDI (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (not destroyed)
  • 3′ cloning site HpaI (not destroyed)
  • 5′ sequencing primer YM213--5' atgccttcttctttttcctacagct
  • 3′ sequencing primer YM215--5' gatgagtttggacaaaccacaact
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 50 μg
  • Concentration 1 μg/μL
  • Pricing $495 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

Purpose

Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.

Delivery

  • Amount 100 μg
  • Concentration 1 μg/μL
  • Pricing $585 USD
  • Storage 4 ℃ (short-term) or -20 ℃ (long-term)

Terms and Licenses

Quality Control

Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.

Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    AgDD was a gift from Thomas Wandless (Addgene plasmid # 78289 ; http://n2t.net/addgene:78289 ; RRID:Addgene_78289)

  • For your References section:

    A method to rapidly create protein aggregates in living cells. Miyazaki Y, Mizumoto K, Dey G, Kudo T, Perrino J, Chen LC, Meyer T, Wandless TJ. Nat Commun. 2016 May 27;7:11689. doi: 10.1038/ncomms11689. 10.1038/ncomms11689 PubMed 27229621
Related items:
Commonly requested with: