Skip to main content

pFUChW nontargeting shRNA
(Plasmid #78522)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78522 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pFUChW
  • Backbone size w/o insert (bp) 10069
  • Total vector size (bp) 10129
  • Modifications to backbone
    EGFP reporter in pFUGW replaced with mCherry
  • Vector type
    Lentiviral, RNAi

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    mCherry
  • gRNA/shRNA sequence
    Non-targeting shRNA
  • Species
    M. musculus (mouse)
  • Promoter UbC

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site AgeI (unknown if destroyed)
  • 3′ cloning site BsrGI (unknown if destroyed)
  • 5′ sequencing primer TGTAATCATTTGGGTCAATATGTAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    modified from Addgene plasmid 25870

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pFUChW nontargeting shRNA was a gift from David Chan (Addgene plasmid # 78522 ; http://n2t.net/addgene:78522 ; RRID:Addgene_78522)
  • For your References section:

    Elimination of paternal mitochondria in mouse embryos occurs through autophagic degradation dependent on PARKIN and MUL1. Rojansky R, Cha MY, Chan DC. Elife. 2016 Nov 17;5. pii: e17896. doi: 10.7554/eLife.17896. 10.7554/eLife.17896 PubMed 27852436