Skip to main content

USP19 sgRNA1
(Plasmid #78585)

Full plasmid sequence is not available for this item.

Loading...

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78585 Standard format: Plasmid sent in bacteria as agar stab 1 $94

Backbone

  • Vector backbone
    pX330-U6-Chimeric_BB-CBh-hSpCas9
  • Backbone size w/o insert (bp) 8500
  • Total vector size (bp) 8530
  • Modifications to backbone
    Mutation D10A was introduced into the Cas9 sequence to generate a Cas9 nickase mutant.
  • Vector type
    Mammalian Expression, CRISPR

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    USP19 sgRNA1
  • gRNA/shRNA sequence
    AGAGCAAGGATGGAGATCCT
  • Species
    H. sapiens (human)
  • Promoter CBh

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BbsI (not destroyed)
  • 3′ cloning site BbsI (not destroyed)
  • 5′ sequencing primer agggatggttggttggtggg
  • 3′ sequencing primer CCAATCCTCCCCCTTGCTGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    We got this vector from Feng Zhang (Addgene 42230) and insert sgRNA for targeting human USP19 gene.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    USP19 sgRNA1 was a gift from Yihong Ye (Addgene plasmid # 78585 ; http://n2t.net/addgene:78585 ; RRID:Addgene_78585)
  • For your References section:

    Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Lee JG, Takahama S, Zhang G, Tomarev SI, Ye Y. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. 10.1038/ncb3372 PubMed 27295555