USP19 sgRNA2
(Plasmid
#78586)
-
Purposedelete USP19 gene in human cell
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 78586 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
Backbone
-
Vector backbonepX330-U6-Chimeric_BB-CBh-hSpCas9
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 8530
-
Modifications to backboneMutation D10A was introduced into the Cas9 sequence to generate a Cas9 nickase mutant.
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameUSP19 sgRNA2
-
Alt nameUSP19 sgRNA2 is "CTTCTGCTTCTTCTTACTAG"
-
SpeciesH. sapiens (human)
-
Entrez GeneUSP19 (a.k.a. ZMYND9)
- Promoter CBh
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer agggatggttggttggtggg
- 3′ sequencing primer CCAATCCTCCCCCTTGCTGT (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byWe got this vector from Feng Zhang (Addgene 42230) and insert sgRNA for targeting human USP19 gene.
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
USP19 sgRNA2 was a gift from Yihong Ye (Addgene plasmid # 78586 ; http://n2t.net/addgene:78586 ; RRID:Addgene_78586) -
For your References section:
Unconventional secretion of misfolded proteins promotes adaptation to proteasome dysfunction in mammalian cells. Lee JG, Takahama S, Zhang G, Tomarev SI, Ye Y. Nat Cell Biol. 2016 Jul;18(7):765-76. doi: 10.1038/ncb3372. Epub 2016 Jun 13. 10.1038/ncb3372 PubMed 27295555