pZac2.1 EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
(Plasmid
#78607)
-
PurposeA single vector AAV-Cas9 system containing SaCas9 under EFs promoter, gRNAs targeting Dmd introns 22 and 23
-
Depositing Lab
-
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78607 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepZac2.1
- Total vector size (bp) 7581
-
Vector typeMammalian Expression, AAV, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameEFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2
-
SpeciesSynthetic
-
Insert Size (bp)4418
- Promoter EF1a-short; U6
-
Tag
/ Fusion Protein
- HA tag (C terminal on insert)
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GAATTCGAGCTCGGTACCC
- 3′ sequencing primer TCGACTCTAGAGGATCCCC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bySaCas9 from Feng Zhang at Broad Institute.
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
gRNA targeting sequences:
CAGTAATGTGTCATACCTTC;
ATATAATAGAAATTATTCAT
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pZac2.1 EFs-SaCas9-U6-Sa DMDR7-U6-SaDMDL2 was a gift from Amy Wagers (Addgene plasmid # 78607 ; http://n2t.net/addgene:78607 ; RRID:Addgene_78607) -
For your References section:
In vivo gene editing in dystrophic mouse muscle and muscle stem cells. Tabebordbar M, Zhu K, Cheng JK, Chew WL, Widrick JJ, Yan WX, Maesner C, Wu EY, Xiao R, Ran FA, Cong L, Zhang F, Vandenberghe LH, Church GM, Wagers AJ. Science. 2016 Jan 22;351(6271):407-11. doi: 10.1126/science.aad5177. Epub 2015 Dec 31. 10.1126/science.aad5177 PubMed 26721686
Map uploaded by the depositor.