Skip to main content

pLJM1-EGFP-BarcodeV1
(Plasmid #78633)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 78633 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pLJM1-EGFP
  • Backbone size w/o insert (bp) 8083
  • Total vector size (bp) 8343
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    GESTALT target V1
  • Alt name
    V1
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    260

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer CGAATTCTCGACCTCGAGACA
  • 3′ sequencing primer CGAAGCTTGAGCTCGAGATCTGAGT
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Addgene 19319

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Addgene 19319 - pLJM1-EGFP, with GESTALT V1 barcode insert at the 3' terminus of EGFP

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pLJM1-EGFP-BarcodeV1 was a gift from Jay Shendure (Addgene plasmid # 78633 ; http://n2t.net/addgene:78633 ; RRID:Addgene_78633)
  • For your References section:

    Whole organism lineage tracing by combinatorial and cumulative genome editing. McKenna A, Findlay GM, Gagnon JA, Horwitz MS, Schier AF, Shendure J. Science. 2016 May 26. pii: aaf7907. 10.1126/science.aaf7907 PubMed 27229144