Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

BC-A1-002
(Plasmid #78689)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 78689 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB1C3
  • Backbone manufacturer
    Registry of Standardized Biological Parts
  • Backbone size w/o insert (bp) 2047
  • Total vector size (bp) 4099
  • Vector type
    Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Turbo
  • Growth instructions
    Reporter gene expression can also be assayed at room temperature (~25C).
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    BBa_J23100-BBa_B0034-luxR-Terminator-pLux-BBa_B0034-GFP-Terminator
  • Species
    Synthetic
  • Insert Size (bp)
    2052

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer tgccacctgacgtctaagaa (VF2)
  • 3′ sequencing primer attaccgcctttgagtgagc (VR)
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    BC-A1-002 was a gift from Brian Chow (Addgene plasmid # 78689 ; http://n2t.net/addgene:78689 ; RRID:Addgene_78689)
  • For your References section:

    Toolbox for Exploring Modular Gene Regulation in Synthetic Biology Training. Magaraci MS, Bermudez JG, Yogish D, Pak DH, Mollov V, Tycko J, Issadore D, Mannickarottu SG, Chow BY. ACS Synth Biol. 2016 Apr 25. 10.1021/acssynbio.6b00057 PubMed 27111289