pGCaMP5
(Plasmid
#78705)
-
PurposeGCaMP5 under the Toxoplasma SAG1 5' UTR. No Toxoplasma selectable marker
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 78705 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backboneN/A
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGCaMP5
-
SpeciesSynthetic
-
Insert Size (bp)1353
- Promoter SAG1 5' UTR
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site Unknown (unknown if destroyed)
- 3′ cloning site Unknown (unknown if destroyed)
- 5′ sequencing primer taatacgactcactatagggc
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGCaMP5 was a gift from Sebastian Lourido (Addgene plasmid # 78705 ; http://n2t.net/addgene:78705 ; RRID:Addgene_78705) -
For your References section:
Using a Genetically Encoded Sensor to Identify Inhibitors of Toxoplasma gondii Ca2+ Signaling. Sidik SM, Hortua Triana MA, Paul AS, El Bakkouri M, Hackett CG, Tran F, Westwood NJ, Hui R, Zuercher WJ, Duraisingh MT, Moreno SN, Lourido S. J Biol Chem. 2016 Apr 29;291(18):9566-80. doi: 10.1074/jbc.M115.703546. Epub 2016 Mar 1. 10.1074/jbc.M115.703546 PubMed 26933036