Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #78706)


Item Catalog # Description Quantity Price (USD)
Plasmid 78706 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


Growth in Bacteria

  • Bacterial Resistance(s)
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Gene/Insert 1

  • Gene/Insert name
  • Species
  • Insert Size (bp)
  • Promoter Toxoplasma SAG1 5' UTR

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site Unknown (unknown if destroyed)
  • 3′ cloning site Unknown (unknown if destroyed)
  • 5′ sequencing primer taatacgactcactatagggc
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
  • Species
    Toxoplasma gondii
  • Insert Size (bp)

Resource Information

  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGCaMP5-DHFR was a gift from Sebastian Lourido (Addgene plasmid # 78706 ; ; RRID:Addgene_78706)
  • For your References section:

    Using a Genetically Encoded Sensor to Identify Inhibitors of Toxoplasma gondii Ca2+ Signaling. Sidik SM, Hortua Triana MA, Paul AS, El Bakkouri M, Hackett CG, Tran F, Westwood NJ, Hui R, Zuercher WJ, Duraisingh MT, Moreno SN, Lourido S. J Biol Chem. 2016 Apr 29;291(18):9566-80. doi: 10.1074/jbc.M115.703546. Epub 2016 Mar 1. 10.1074/jbc.M115.703546 PubMed 26933036