Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pET3a-OSF-CypA
(Plasmid #79039)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79039 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pET3a
  • Backbone manufacturer
    Novagen
  • Backbone size w/o insert (bp) 4640
  • Total vector size (bp) 5267
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    OneSTrEP-FLAG- Cyclophilin A
  • Alt name
    OSF-CypA
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    663
  • GenBank ID
    NM_021130.4
  • Entrez Gene
    PPIA (a.k.a. CYPA, CYPH, HEL-S-69p)
  • Promoter T7
  • Tag / Fusion Protein
    • OneSTrEP-FLAG (N terminal on insert)

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer TAATACGACTCACTATAGGG
  • 3′ sequencing primer TATGCTAGTTATTGCTCAG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pET3a-OSF-CypA was a gift from Wesley Sundquist (Addgene plasmid # 79039 ; http://n2t.net/addgene:79039 ; RRID:Addgene_79039)
  • For your References section:

    Primate TRIM5 proteins form hexagonal nets on HIV-1 capsids. Li YL, Chandrasekaran V, Carter SD, Woodward CL, Christensen DE, Dryden KA, Pornillos O, Yeager M, Ganser-Pornillos BK, Jensen GJ, Sundquist WI. Elife. 2016 Jun 2;5. pii: e16269. doi: 10.7554/eLife.16269. 10.7554/eLife.16269 PubMed 27253068