Skip to main content

pScalps_Puro_mCebpe
(Plasmid #79076)

Full plasmid sequence is not available for this item.

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79076 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pScalps
  • Backbone size w/o insert (bp) 7740
  • Total vector size (bp) 8755
  • Vector type
    Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    Cebp epsilon
  • Alt name
    CCAAT/Enhancer Binding Protein (C/EBP), Epsilon
  • Alt name
    C/EBP Epsilon
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1176
  • Entrez Gene
    Cebpe (a.k.a. C/EBP, C/EBPe, C/EBPepsilon, CR, CRP1, Gm294)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site EcoRI (not destroyed)
  • 5′ sequencing primer GCTTCTCGCTTCTGTTCG
  • 3′ sequencing primer GTTGTCAAGCGATGAGGCGCGT
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pScalps_Puro_mCebpe was a gift from Silvia Monticelli (Addgene plasmid # 79076 ; http://n2t.net/addgene:79076 ; RRID:Addgene_79076)
  • For your References section:

    TET2 Regulates Mast Cell Differentiation and Proliferation through Catalytic and Non-catalytic Activities. Montagner S, Leoni C, Emming S, Della Chiara G, Balestrieri C, Barozzi I, Piccolo V, Togher S, Ko M, Rao A, Natoli G, Monticelli S. Cell Rep. 2016 May 17;15(7):1566-79. doi: 10.1016/j.celrep.2016.04.044. Epub 2016 May 5. 10.1016/j.celrep.2016.04.044 PubMed 27160912