-
PurposeAll-in-one CRISPR/Cas9 vector with CAG promoter for expression in human ESC/iPSC
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79144 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSpCas9(BB)-2A-GFP (PX458)
-
Backbone manufacturerAddgene #48138
- Total vector size (bp) 10243
-
Modifications to backboneReplaced CBh promoter with CAG promoter
-
Vector typeMammalian Expression, CRISPR
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameSpCas9
- Promoter CAG
-
Tag
/ Fusion Protein
- 2A-GFP (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BbsI (not destroyed)
- 3′ cloning site BbsI (not destroyed)
- 5′ sequencing primer ACTATCATATGCTTACCGTAAC
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThis plasmid was modified from Addgene plasmid #48138 and contains GFP cassette.
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCAG-SpCas9-GFP-U6-gRNA was a gift from Jizhong Zou (Addgene plasmid # 79144 ; http://n2t.net/addgene:79144 ; RRID:Addgene_79144) -
For your References section:
The ribosomal prolyl-hydroxylase OGFOD1 decreases during cardiac differentiation and modulates translation and splicing. Stoehr A, Kennedy L, Yang Y, Patel S, Lin Y, Linask KL, Fergusson M, Zhu J, Gucek M, Zou J, Murphy E. JCI Insight. 2019 May 21;5. pii: 128496. doi: 10.1172/jci.insight.128496. 10.1172/jci.insight.128496 PubMed 31112528