Skip to main content

pAIDA1
(Plasmid #79180)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79180 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pKM1D
  • Backbone size w/o insert (bp) 3800
  • Total vector size (bp) 3600
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol, 25 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    Adhesin Involved in Diffuse Adherence
  • Alt name
    AIDA
  • Species
    Synthetic; E. coli
  • Insert Size (bp)
    1800
  • Promoter lacUV5
  • Tags / Fusion Proteins
    • His (N terminal on insert)
    • Myc (C terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site HindIII (not destroyed)
  • 3′ cloning site BclI (destroyed during cloning)
  • 5′ sequencing primer GAGCGGATAACAATTTCACACAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAIDA1 was a gift from Gen Larsson (Addgene plasmid # 79180 ; http://n2t.net/addgene:79180 ; RRID:Addgene_79180)
  • For your References section:

    A dual tag system for facilitated detection of surface expressed proteins in Escherichia coli. Jarmander J, Gustavsson M, Do TH, Samuelson P, Larsson G. Microb Cell Fact. 2012 Sep 3;11:118. doi: 10.1186/1475-2859-11-118. 10.1186/1475-2859-11-118 PubMed 22943700