pRS315e_pGal-dCas9-SH3-pGal-PmCDA1-SHL
              
              
                (Plasmid
                
                #79614)
              
            
            
            
          - 
            PurposeExpresses dCas9-SH3 and PmCDA1-SHL in yeast cells
- 
              Depositing Lab
- 
          Publication
- 
          Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79614 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
- 
            Vector backbonepRS315
- Backbone size w/o insert (bp) 6000
- Total vector size (bp) 12088
- 
              Modifications to backboneEcoRI site is mutated in Leu2
- 
              Vector typeYeast Expression
- 
                Selectable markersLEU2
Growth in Bacteria
- 
            Bacterial Resistance(s)Ampicillin, 100 μg/mL
- 
            Growth Temperature37°C
- 
            Growth Strain(s)DH5alpha
- 
            Copy numberHigh Copy
Gene/Insert 1
- 
                Gene/Insert nameSpCas9
- 
                    SpeciesStreptococcus pyogenes
- 
                  MutationD10A and H840A for nuclease deficient Cas9
- Promoter pGal1
- 
    
        Tag
        / Fusion Protein
    - SH3 domain (C terminal on insert)
 
Cloning Information for Gene/Insert 1
- Cloning method Gibson Cloning
- 5′ sequencing primer tagcatctatgcgacacgg
- 3′ sequencing primer gtaaaacgacggccagt (Common Sequencing Primers)
Gene/Insert 2
- 
                Gene/Insert namePmCDA1
- Promoter pGal10
- 
    
        Tag
        / Fusion Protein
    - SHL (C terminal on insert)
 
Cloning Information for Gene/Insert 2
- Cloning method Gibson Cloning
- 5′ sequencing primer caggaaacagctatgac
- 3′ sequencing primer gctctttacatttccacaac (Common Sequencing Primers)
Resource Information
- 
            A portion of this plasmid was derived from a plasmid made byThis is derived from Addgene plasmid ID43804.
Terms and Licenses
- 
        Academic/Nonprofit Terms
- 
      Industry Terms- Not Available to Industry
 
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
- 
              For your Materials & Methods section: pRS315e_pGal-dCas9-SH3-pGal-PmCDA1-SHL was a gift from Akihiko Kondo (Addgene plasmid # 79614 ; http://n2t.net/addgene:79614 ; RRID:Addgene_79614)
- 
                For your References section: Targeted nucleotide editing using hybrid prokaryotic and vertebrate adaptive immune systems. Nishida K, Arazoe T, Yachie N, Banno S, Kakimoto M, Tabata M, Mochizuki M, Miyabe A, Araki M, Hara KY, Shimatani Z, Kondo A. Science. 2016 Aug 4. pii: aaf8729. 10.1126/science.aaf8729 PubMed 27492474
