Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

pTRE Tight ArchT-GFP
(Plasmid #79627)

Full plasmid sequence is not available for this item.

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79627 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pTRE-Tight
  • Backbone manufacturer
    Clontech
  • Backbone size w/o insert (bp) 2605
  • Vector type
    Mammalian Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    ArchT
  • Insert Size (bp)
    1668
  • Mutation
    ArchT is a more sensitive version of Arch (archaerhodpsin; light-driven outward proton pump)
  • GenBank ID
    HM367072.1
  • Promoter Tet responsive Ptight promoter
  • Tag / Fusion Protein
    • EGFP (C terminal on backbone)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site ClaI (not destroyed)
  • 5′ sequencing primer AGGCGTATCACGAGGCCCTTTCGT
  • 3′ sequencing primer tattaccgcctttgagtgagctga
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Dr. Ed Boyden at MIT

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

SV40 polyA in pTRE-Tight does not work in TG animal for some reason, additional intron + polyA from pMSG vector was inserted (please see vector map).

To make plasmid, intron+polyA part from pMSG was PCR amplified and ligated to the HindIII/XbaI sites of pTRE-Tight (3’ primer has AatII site also for linearization later). ArchT-GFP was subcloned into pTRE-Tight with BamHI/ClaI.

Linearize the vector with AatII digestion to make transgenic mouse

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRE Tight ArchT-GFP was a gift from Yasunori Hayashi (Addgene plasmid # 79627 ; http://n2t.net/addgene:79627 ; RRID:Addgene_79627)
  • For your References section:

    Inhibiting the Activity of CA1 Hippocampal Neurons Prevents the Recall of Contextual Fear Memory in Inducible ArchT Transgenic Mice. Sakaguchi M, Kim K, Yu LM, Hashikawa Y, Sekine Y, Okumura Y, Kawano M, Hayashi M, Kumar D, Boyden ES, McHugh TJ, Hayashi Y. PLoS One. 2015 Jun 15;10(6):e0130163. doi: 10.1371/journal.pone.0130163. eCollection 2015. PONE-D-15-13315 [pii] PubMed 26075894