pTRE Tight ArchT-GFP
(Plasmid
#79627)
-
PurposeTetracycline-dependent expression of ArchT-EGFP in mammalian cells
-
Depositing Lab
-
Depositing OrganizationRIKEN Center for Brain Science
Located in Japan -
Sequence Information
Full plasmid sequence is not available for this item.
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79627 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $94 | |
| DNA | 79627-D50 | 50 μg of DNA in Tris buffer | $495 | ||
| DNA | 79627-D100 | 100 μg of DNA in Tris buffer | $585 | ||
Backbone
-
Vector backbonepTRE-Tight
-
Backbone manufacturerClontech
- Backbone size w/o insert (bp) 2605
-
Vector typeMammalian Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameArchT
-
Insert Size (bp)1668
-
MutationArchT is a more sensitive version of Arch (archaerhodpsin; light-driven outward proton pump)
-
GenBank IDHM367072.1
- Promoter Tet responsive Ptight promoter
-
Tag
/ Fusion Protein
- EGFP (C terminal on backbone)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site ClaI (not destroyed)
- 5′ sequencing primer AGGCGTATCACGAGGCCCTTTCGT
- 3′ sequencing primer tattaccgcctttgagtgagctga
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byDr. Ed Boyden at MIT
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
SV40 polyA in pTRE-Tight does not work in TG animal for some reason, additional intron + polyA from pMSG vector was inserted (please see vector map).
To make plasmid, intron+polyA part from pMSG was PCR amplified and ligated to the HindIII/XbaI sites of pTRE-Tight (3’ primer has AatII site also for linearization later). ArchT-GFP was subcloned into pTRE-Tight with BamHI/ClaI.
Linearize the vector with AatII digestion to make transgenic mouse
DNA (Catalog # 79627-D50)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 50 μg
- Concentration 1 μg/μL
- Pricing $495 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
DNA (Catalog # 79627-D100)
Purpose
Ready-to-use, high-purity DNA prep. DNA aliquots are suitable for use in mammalian cell transfections and other molecular biology applications.
Delivery
- Amount 100 μg
- Concentration 1 μg/μL
- Pricing $585 USD
- Storage 4 ℃ (short-term) or -20 ℃ (long-term)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Quality Control
Every DNA prep is verified by next-generation sequencing, confirming plasmid identity, sequence integrity, and absence of DNA contaminants. Concentration is confirmed to be within ±2.5% of the stated concentration.
Our production process has been validated to consistently yield endotoxin levels below 1.0 EU/μg. Individual lots are not tested for endotoxin.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRE Tight ArchT-GFP was a gift from Yasunori Hayashi (Addgene plasmid # 79627 ; http://n2t.net/addgene:79627 ; RRID:Addgene_79627) -
For your References section:
Inhibiting the Activity of CA1 Hippocampal Neurons Prevents the Recall of Contextual Fear Memory in Inducible ArchT Transgenic Mice. Sakaguchi M, Kim K, Yu LM, Hashikawa Y, Sekine Y, Okumura Y, Kawano M, Hayashi M, Kumar D, Boyden ES, McHugh TJ, Hayashi Y. PLoS One. 2015 Jun 15;10(6):e0130163. doi: 10.1371/journal.pone.0130163. eCollection 2015. PONE-D-15-13315 [pii] PubMed 26075894
Map uploaded by the depositor.
