Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pDEST-C102-GFP
(Plasmid #79760)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79760 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pDEST17
  • Backbone manufacturer
    invitrogen
  • Vector type
    Bacterial Expression
  • Promoter T7
  • Tag / Fusion Protein
    • GFP-His10 (C terminal on backbone)

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    ccdB Survival
  • Copy number
    High Copy

Cloning Information

  • Cloning method Gateway Cloning
  • 5′ sequencing primer cacgaagtggctagcaaaggagaagaacttttcactggag
  • 3′ sequencing primer TTTGTAGAGCTCATCCATGCCATGTGTAATC
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    Michael Dyson

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pDEST-C102-GFP was a gift from Nico Dissmeyer & Michael Dyson (Addgene plasmid # 79760)
  • For your References section:

    Production of soluble mammalian proteins in Escherichia coli: identification of protein features that correlate with successful expression. Dyson MR, Shadbolt SP, Vincent KJ, Perera RL, McCafferty J. BMC Biotechnol. 2004 Dec 14;4:32. 10.1186/1472-6750-4-32 PubMed 15598350