pDEST-C102-GFP
(Plasmid
#79760)
-
Purpose(Empty Backbone) DEST vector for bacterial expression
-
Depositing Labs
-
Publication
-
Sequence Information
Ordering
This material is available to academics and nonprofits only.
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79760 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 | |
Backbone
-
Vector backbonepDEST17
-
Backbone manufacturerinvitrogen
-
Vector typeBacterial Expression
- Promoter T7
-
Tag
/ Fusion Protein
- GFP-His10 (C terminal on backbone)
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Ampicillin, 25 & 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)ccdB Survival
-
Copy numberHigh Copy
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer cacgaagtggctagcaaaggagaagaacttttcactggag
- 3′ sequencing primer TTTGTAGAGCTCATCCATGCCATGTGTAATC (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byMichael Dyson
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
How to cite this plasmid
( Back to top)
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pDEST-C102-GFP was a gift from Nico Dissmeyer & Michael Dyson (Addgene plasmid # 79760) -
For your References section:
Production of soluble mammalian proteins in Escherichia coli: identification of protein features that correlate with successful expression. Dyson MR, Shadbolt SP, Vincent KJ, Perera RL, McCafferty J. BMC Biotechnol. 2004 Dec 14;4:32. 10.1186/1472-6750-4-32 PubMed 15598350
