pSAH0016
(Plasmid
#79824)
-
PurposeDual selection plasmid with lac operator, selection for binding with spectinomycin, for non-binding with chloramphenicol
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79824 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepSB4X5
-
Backbone manufacturerBioBrick
- Backbone size w/o insert (bp) 2406
- Total vector size (bp) 4271
-
Modifications to backboneremoval of backbone resistance from pSB4K5
Growth in Bacteria
-
Bacterial Resistance(s)Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert namecat
-
Alt namechloramphenicol acetyltransferase
-
Alt namewith strong promoter with lac operator
-
Insert Size (bp)755
- Promoter AATTCAAAAAAATGCTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTCCACACAT
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer pQE-RP (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameaadA
-
Alt namespectinomycin adenylyltransferase
-
Alt namewith native promoter, opposite to cat
-
Insert Size (bp)1110
- Promoter native aadA
Cloning Information for Gene/Insert 2
- Cloning method Restriction Enzyme
- 5′ cloning site PstI (unknown if destroyed)
- 3′ cloning site HindIII (unknown if destroyed)
- 5′ sequencing primer ATTACCGCCTTTGAGTGAGC (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pSAH0016 was a gift from Katja Arndt (Addgene plasmid # 79824 ; http://n2t.net/addgene:79824 ; RRID:Addgene_79824) -
For your References section:
Long-range transcriptional interference in E. coli used to construct a dual positive selection system for genetic switches. Hoffmann SA, Kruse SM, Arndt KM. Nucleic Acids Res. 2016 Jun 2;44(10):e95. doi: 10.1093/nar/gkw125. Epub 2016 Feb 29. 10.1093/nar/gkw125 PubMed 26932362