Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pSAH0016
(Plasmid #79824)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79824 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pSB4X5
  • Backbone manufacturer
    BioBrick
  • Backbone size w/o insert (bp) 2406
  • Total vector size (bp) 4271
  • Modifications to backbone
    removal of backbone resistance from pSB4K5

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Spectinomycin, 25 & 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert 1

  • Gene/Insert name
    cat
  • Alt name
    chloramphenicol acetyltransferase
  • Alt name
    with strong promoter with lac operator
  • Insert Size (bp)
    755
  • Promoter AATTCAAAAAAATGCTTGACAATTAATCATCGGCTCGTATAATGTGTGGAATTGTGAGCGCTCACAATTCCACACAT

Cloning Information for Gene/Insert 1

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoRI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer pQE-RP
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    aadA
  • Alt name
    spectinomycin adenylyltransferase
  • Alt name
    with native promoter, opposite to cat
  • Insert Size (bp)
    1110
  • Promoter native aadA

Cloning Information for Gene/Insert 2

  • Cloning method Restriction Enzyme
  • 5′ cloning site PstI (unknown if destroyed)
  • 3′ cloning site HindIII (unknown if destroyed)
  • 5′ sequencing primer ATTACCGCCTTTGAGTGAGC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pSAH0016 was a gift from Katja Arndt (Addgene plasmid # 79824 ; http://n2t.net/addgene:79824 ; RRID:Addgene_79824)
  • For your References section:

    Long-range transcriptional interference in E. coli used to construct a dual positive selection system for genetic switches. Hoffmann SA, Kruse SM, Arndt KM. Nucleic Acids Res. 2016 Jun 2;44(10):e95. doi: 10.1093/nar/gkw125. Epub 2016 Feb 29. 10.1093/nar/gkw125 PubMed 26932362
Commonly requested with: