R10-3 /pQE-30
(Plasmid
#79859)
-
PurposeThe first mutant of the Aequorea victoria green fluorescent protein that forms a red chromophore.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79859 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepQE-30
-
Backbone manufacturerQIAGEN
- Backbone size w/o insert (bp) 3500
- Total vector size (bp) 4250
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameR10-3
-
Alt nameR103
-
SpeciesSynthetic
-
Insert Size (bp)750
-
MutationAequorea victoria green fluorescent protein (avGFP) with substitutions F46L, F64L, V68N, V163A, K162Q, I167V, and I171L.
-
GenBank IDKX377674 KX377674
- Promoter T5 promoter / lac operator
-
Tag
/ Fusion Protein
- HisTag (N terminal on insert)
Cloning Information
- Cloning method Unknown
- 5′ sequencing primer ATTGTGAGCGGATAACAATTTC
- 3′ sequencing primer CCGAGCGTTCTGAACAAATC
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
R10-3 /pQE-30 was a gift from Konstantin Lukyanov (Addgene plasmid # 79859 ; http://n2t.net/addgene:79859 ; RRID:Addgene_79859) -
For your References section:
The first mutant of the Aequorea victoria green fluorescent protein that forms a red chromophore. Mishin AS, Subach FV, Yampolsky IV, King W, Lukyanov KA, Verkhusha VV. Biochemistry. 2008 Apr 22;47(16):4666-73. doi: 10.1021/bi702130s. Epub 2008 Mar 27. 10.1021/bi702130s PubMed 18366185