Skip to main content

pAAV-Ef1a-DIO_EGFP-RandE3
(Plasmid #79872)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79872 Standard format: Plasmid sent in bacteria as agar stab 1 $94

This service is available to academics and nonprofits only.

Please log in to submit a packaging request.
  • Serotype
    Select serotype for details
  • Pricing
    Select serotype and quantity
  • How this works
    • Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
    • Addgene will quickly confirm that we can produce a high-quality prep for you.
    • Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
    • Receive your prep in 6–9 weeks after the MTA is approved by your organization.
    • Learn more about our Packaged on Request Service.

Backbone

  • Vector backbone
    pCAG
  • Backbone size w/o insert (bp) 4026
  • Total vector size (bp) 6910
  • Vector type
    Mammalian Expression, AAV, Cre/Lox, Synthetic Biology

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    GFP-RandE3
  • Species
    R. norvegicus (rat), Synthetic
  • Insert Size (bp)
    1299
  • Promoter EF1a
  • Tags / Fusion Proteins
    • GFP (N terminal on insert)
    • HA

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site NdeI (not destroyed)
  • 3′ cloning site BsrGI (not destroyed)
  • 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
  • 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
  • (Common Sequencing Primers)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pAAV-Ef1a-DIO_EGFP-RandE3 was a gift from Don Arnold (Addgene plasmid # 79872 ; http://n2t.net/addgene:79872 ; RRID:Addgene_79872)
  • For your References section:

    An E3-ligase-based method for ablating inhibitory synapses. Gross GG, Straub C, Perez-Sanchez J, Dempsey WP, Junge JA, Roberts RW, Trinh LA, Fraser SE, De Koninck Y, De Koninck P, Sabatini BL, Arnold DB. Nat Methods. 2016 Jun 6. doi: 10.1038/nmeth.3894. 10.1038/nmeth.3894 PubMed 27271196