pAAV-Ef1a-DIO_EGFP-RandE3
(Plasmid
#79872)
-
PurposeFor generating adeno-associated virus to express RandE3 under the EF1a promoter in a 'Cre-on' dependent manner.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 79872 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backbonepCAG
- Backbone size w/o insert (bp) 4026
- Total vector size (bp) 6910
-
Vector typeMammalian Expression, AAV, Cre/Lox, Synthetic Biology
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameGFP-RandE3
-
SpeciesR. norvegicus (rat), Synthetic
-
Insert Size (bp)1299
- Promoter EF1a
-
Tags
/ Fusion Proteins
- GFP (N terminal on insert)
- HA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site NdeI (not destroyed)
- 3′ cloning site BsrGI (not destroyed)
- 5′ sequencing primer TCAAGCCTCAGACAGTGGTTC
- 3′ sequencing primer GTAATCCAGAGGTTGATTATCG
- (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pAAV-Ef1a-DIO_EGFP-RandE3 was a gift from Don Arnold (Addgene plasmid # 79872 ; http://n2t.net/addgene:79872 ; RRID:Addgene_79872) -
For your References section:
An E3-ligase-based method for ablating inhibitory synapses. Gross GG, Straub C, Perez-Sanchez J, Dempsey WP, Junge JA, Roberts RW, Trinh LA, Fraser SE, De Koninck Y, De Koninck P, Sabatini BL, Arnold DB. Nat Methods. 2016 Jun 6. doi: 10.1038/nmeth.3894. 10.1038/nmeth.3894 PubMed 27271196