Skip to main content

pWUKI 1+2
(Plasmid #79879)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 79879 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pCDF-1b
  • Total vector size (bp) 6068
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Spectinomycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas1
  • Species
    E. coli
  • GenBank ID
    NP_417235.1
  • Promoter T7

Cloning Information for Gene/Insert 1

Gene/Insert 2

  • Gene/Insert name
    Cas2
  • Species
    E. coli
  • GenBank ID
    NP_417234.2
  • Promoter T7

Cloning Information for Gene/Insert 2

  • Cloning method Unknown
  • 5′ sequencing primer CACTGTTGTACCGAAAGCTTT
  • 3′ sequencing primer GCTAGTTATTGCTCAGCGG
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    CRISPR Array
  • Species
    E. coli (K12)

Cloning Information for Gene/Insert 3

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    Based on Plasmid #72676 from Udi Qimron.

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pWUKI 1+2 was a gift from George Church (Addgene plasmid # 79879 ; http://n2t.net/addgene:79879 ; RRID:Addgene_79879)
  • For your References section:

    Molecular recordings by directed CRISPR spacer acquisition. Shipman SL, Nivala J, Macklis JD, Church GM. Science. 2016 Jun 9. pii: aaf1175. 10.1126/science.aaf1175 PubMed 27284167