Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pRS416gT-GalL-Cas9
(Plasmid #79903)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 79903 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pRS416
  • Backbone size w/o insert (bp) 4898
  • Total vector size (bp) 12421
  • Vector type
    Yeast Expression, CRISPR
  • Selectable markers
    URA3

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Gene/Insert 1

  • Gene/Insert name
    Cas9
  • Species
    Synthetic
  • Promoter GalL

Cloning Information for Gene/Insert 1

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GACGCCACACTGATTCATCAG
  • 3′ sequencing primer TGCTCGGCACCTTGTACTCG
  • (Common Sequencing Primers)

Gene/Insert 2

  • Gene/Insert name
    guide RNA (gRNA)
  • Species
    Synthetic
  • Promoter RPR1 promoter with TetO site

Cloning Information for Gene/Insert 2

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GTTCGTGCACACAGCCC
  • 3′ sequencing primer agtttggcgaacacttcacc
  • (Common Sequencing Primers)

Gene/Insert 3

  • Gene/Insert name
    Tetracycline Repressor
  • Alt name
    TetR
  • Insert Size (bp)
    624
  • Promoter GPM1 promoter

Cloning Information for Gene/Insert 3

  • Cloning method Gibson Cloning
  • 5′ sequencing primer gagtacaaacgcatgaaatcc
  • 3′ sequencing primer CGGTAATACGGTTATCCACAGAATCAGGGGATAACGCAGGAAAG
  • (Common Sequencing Primers)

Resource Information

  • Supplemental Documents
  • A portion of this plasmid was derived from a plasmid made by
    GalL Cas9 was obtained from: https://www.addgene.org/43804/
  • Terms and Licenses
  • Industry Terms
    • Not Available to Industry

Depositor Comments

For a nice map of all the features on this plasmid check out this benchling map: https://benchling.com/s/28w2TI93/edit

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pRS416gT-GalL-Cas9 was a gift from Ronald Davis (Addgene plasmid # 79903 ; http://n2t.net/addgene:79903 ; RRID:Addgene_79903)
  • For your References section:

    Distinct patterns of Cas9 mismatch tolerance in vitro and in vivo. Fu BX, St Onge RP, Fire AZ, Smith JD. Nucleic Acids Res. 2016 May 19. pii: gkw417. 10.1093/nar/gkw417 PubMed 27198218