rgef-1p::NmBirA
(Plasmid
#79971)
-
Purposeencodes E.coli biotin-ligase under neuronal promotor for C.elegans
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 79971 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepBD95
-
Backbone manufacturerVidal et al
- Backbone size w/o insert (bp) 7059
- Total vector size (bp) 8349
-
Vector typeWorm Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameBirA
-
SpeciesC. elegans (nematode)
-
Insert Size (bp)1170
- Promoter rgef
-
Tag
/ Fusion Protein
- NLS::myc (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site KpnI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer atgaaggataatactgttcc
- 3′ sequencing primer ggaaacagttatgtttggtatattgg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
rgef-1p::NmBirA was a gift from Baris Tursun (Addgene plasmid # 79971 ; http://n2t.net/addgene:79971 ; RRID:Addgene_79971) -
For your References section:
A tissue-specific protein purification approach in Caenorhabditis elegans identifies novel interaction partners of DLG-1/Discs large. Waaijers S, Munoz J, Berends C, Ramalho JJ, Goerdayal SS, Low TY, Zoumaro-Djayoon AD, Hoffmann M, Koorman T, Tas RP, Harterink M, Seelk S, Kerver J, Hoogenraad CC, Bossinger O, Tursun B, van den Heuvel S, Heck AJ, Boxem M. BMC Biol. 2016 Aug 9;14:66. doi: 10.1186/s12915-016-0286-x. 10.1186/s12915-016-0286-x PubMed 27506200