Skip to main content

pMT-myl7-cytoBirA-2A-mCherry_Ras
(Plasmid #80060)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80060 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pMT
  • Backbone size w/o insert (bp) 5139
  • Total vector size (bp) 7194
  • Vector type
    Bacterial Expression ; zebrafish biotagging

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Biotin ligase (BirA), a Thosea asigna virus peptide (2A), and mCherry protein
  • Species
    D. rerio (zebrafish)
  • Insert Size (bp)
    2055
  • Promoter Myl7 promoter
  • Tag / Fusion Protein
    • 3x HA (N terminal on insert)

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer AAGGTTAAGCGGCCGCAAGC
  • 3′ sequencing primer taatacgactcactatagggag
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMT-myl7-cytoBirA-2A-mCherry_Ras was a gift from Tatjana Sauka-Spengler (Addgene plasmid # 80060 ; http://n2t.net/addgene:80060 ; RRID:Addgene_80060)
  • For your References section:

    Biotagging of Specific Cell Populations in Zebrafish Reveals Gene Regulatory Logic Encoded in the Nuclear Transcriptome. Trinh LA, Chong-Morrison V, Gavriouchkina D, Hochgreb-Hagele T, Senanayake U, Fraser SE, Sauka-Spengler T. Cell Rep. 2017 Apr 11;19(2):425-440. doi: 10.1016/j.celrep.2017.03.045. 10.1016/j.celrep.2017.03.045 PubMed 28402863