pMS1088
(Plasmid
#80159)
-
PurposepET-Duet for bacterial expression of Cys-NuG2(4x)-Ald and co-expression of Mycobacterium tuberculosis Formylglycine Generating Enzyme
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80159 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepET-32 Xa/LIC
-
Backbone manufacturerEMD Millipore
- Backbone size w/o insert (bp) 6250
- Total vector size (bp) 7446
-
Modifications to backboneThe backbone was initially modified as described in Lee, C.-D. et al. An improved SUMO fusion protein system for effective production of native proteins. Protein Sci. Publ. Protein Soc. 17, 1241–1248 (2008). We then switched the Ampicillin resistance to Kanamycin.
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameHisSUMO-Cys-4xNuG2-Ald
-
SpeciesSynthetic
-
Insert Size (bp)1125
- Promoter T7
-
Tag
/ Fusion Protein
- HisSUMO (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site SfoI (unknown if destroyed)
- 3′ cloning site SacI (unknown if destroyed)
- 5′ sequencing primer taatacgactcactatagg
- 3′ sequencing primer GATTATGCGGCCGTGTACAA
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe vector backbone containing the His-SUMO tag was obtained from Dr. Wang of the Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan. (IMB, AS).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pMS1088 was a gift from Marcelo Sousa (Addgene plasmid # 80159 ; http://n2t.net/addgene:80159 ; RRID:Addgene_80159) -
For your References section:
Rapid Characterization of a Mechanically Labile alpha-helical Protein Enabled by Efficient Site-Specific Bioconjugation. Walder R, LeBlanc MA, Van Patten WJ, Edwards D, Greenberg JA, Adhikari A, Okoniewski SR, Sullan RMA, Rabuka D, Sousa MC, Perkins TT. J Am Chem Soc. 2017 Jul 5. doi: 10.1021/jacs.7b02958. 10.1021/jacs.7b02958 PubMed 28677396