Skip to main content

pMS1088
(Plasmid #80159)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80159 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pET-32 Xa/LIC
  • Backbone manufacturer
    EMD Millipore
  • Backbone size w/o insert (bp) 6250
  • Total vector size (bp) 7446
  • Modifications to backbone
    The backbone was initially modified as described in Lee, C.-D. et al. An improved SUMO fusion protein system for effective production of native proteins. Protein Sci. Publ. Protein Soc. 17, 1241–1248 (2008). We then switched the Ampicillin resistance to Kanamycin.

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Low Copy

Gene/Insert

  • Gene/Insert name
    HisSUMO-Cys-4xNuG2-Ald
  • Species
    Synthetic
  • Insert Size (bp)
    1125
  • Promoter T7
  • Tag / Fusion Protein
    • HisSUMO (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site SfoI (unknown if destroyed)
  • 3′ cloning site SacI (unknown if destroyed)
  • 5′ sequencing primer taatacgactcactatagg
  • 3′ sequencing primer GATTATGCGGCCGTGTACAA
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    The vector backbone containing the His-SUMO tag was obtained from Dr. Wang of the Institute of Molecular Biology, Academia Sinica, Taipei, Taiwan. (IMB, AS).
  • Article Citing this Plasmid

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry

Trademarks:

  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pMS1088 was a gift from Marcelo Sousa (Addgene plasmid # 80159 ; http://n2t.net/addgene:80159 ; RRID:Addgene_80159)
  • For your References section:

    Rapid Characterization of a Mechanically Labile alpha-helical Protein Enabled by Efficient Site-Specific Bioconjugation. Walder R, LeBlanc MA, Van Patten WJ, Edwards D, Greenberg JA, Adhikari A, Okoniewski SR, Sullan RMA, Rabuka D, Sousa MC, Perkins TT. J Am Chem Soc. 2017 Jul 5. doi: 10.1021/jacs.7b02958. 10.1021/jacs.7b02958 PubMed 28677396