pFUSEss-CHIg-mG2a_M18
(Plasmid #105930)

• Purpose: Expression plasmid coding for heavy chain of mouse IgG2a antibody specific to antigen B of the ABO blood group system, clone M18.
• Depositing Lab: Joanna Bereta
• Publication: Klaus et al Front Immunol. 2018 May 23;9:1096. doi: 10.3389/fimmu.2018.01096. eCollection 2018.

Backbone

• Vector backbone: pFUSEss-CHIg-mG2a
• Backbone manufacturer: Invivogen
• Backbone size w/o insert (bp): 4489
• Total vector size (bp): 4844
• Vector type: Mammalian Expression
• Selectable markers: Zeocin

Growth in Bacteria

• Bacterial Resistance(s): Bleocin (Zeocin), 50 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: IgG2b heavy chain
• Alt name: Ighg2b
• Alt name: gamma2b
• Species: M. musculus (mouse)
• Insert Size (bp): 355
• Entrez Gene: Ighg2b (a.k.a. IgG2b, Igh-3, gamma2b)
• Promoter: hEF1-HTLV prom

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: EcoR1 (not destroyed)
• 3′ cloning site: AfeI (not destroyed)
• 5′ sequencing primer: ATGTACAGGATGCAACTCCTG
• 3′ sequencing primer: EBV-rev

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry