-
PurposeExpression plasmid coding for kappa light chain of mouse antibody specific to antigen B of the ABO blood group system, clone M18.
-
Depositing Lab
-
Sequence Information
-
Sequences (3) — Accept Affinity Reagent Sequence Policy
-
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82358 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepFUSE2ss-CLIg-mK
-
Backbone manufacturerInvivogen
- Backbone size w/o insert (bp) 3862
- Total vector size (bp) 4177
-
Modifications to backbonenone
-
Vector typeMammalian Expression
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Blasticidin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Growth instructionsTop10 or DH5alpha could be selected on LB LOW SALT with 100 micrograms/ml Blasticidin.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namemouse immunoglobulin kappa light chain, variable fragment derived from clone M18
-
Alt nameIgk
-
SpeciesM. musculus (mouse)
-
Insert Size (bp)339
-
GenBank IDNC_000072.6
-
Entrez GeneIgk (a.k.a. kappa)
-
Entrez GeneIgkc (a.k.a. Igk-C)
-
Entrez GeneIgk-V
- Promoter hEF1-HTLV prom
-
Tag
/ Fusion Protein
- none
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (not destroyed)
- 3′ cloning site BstAPI (not destroyed)
- 5′ sequencing primer AGATGTTGTTCTGACCCAAACTC
- 3′ sequencing primer ACACTCATTCCTGTTGAAGCTC (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pFUSE2ss-CLIg-mK_M18 was a gift from Joanna Bereta (Addgene plasmid # 82358 ; http://n2t.net/addgene:82358 ; RRID:Addgene_82358) -
For your References section:
Agglutinating mouse IgG3 compares favourably with IgMs in typing of the blood group B antigen: Functionality and stability studies. Klaus T, Bzowska M, Kulesza M, Kabat AM, Jemiola-Rzeminska M, Czaplicki D, Makuch K, Jucha J, Karabasz A, Bereta J. Sci Rep. 2016 Aug 3;6:30938. doi: 10.1038/srep30938. 10.1038/srep30938 PubMed 27484487