pKT3Ts-goldyTALEN
(Plasmid
#80330)
-
Purpose(Empty Backbone) Updated TALEN vector; compatible with the Golden Gate TALEN assembly protocol. More stable backbone with reduced recombination compared to pT3Ts-goldyTALEN due to the removal of a lacZ sequence
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80330 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepK-SV40AX2woSV40
- Backbone size (bp) 3863
-
Modifications to backboneBase pair mutation T>C at position 438 of the Kan resistance gene to silence an unwanted EspI restriction site. Suggested linearization site is SpeI.
-
Vector typeBacterial Expression, TALEN
- Promoter T3
-
Selectable markersLacZ
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer ttggcgtcggcaaacagtgg
- 3′ sequencing primer Ggcgacgaggtggtcgttgg (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pKT3Ts-goldyTALEN was a gift from Jeffrey Essner (Addgene plasmid # 80330 ; http://n2t.net/addgene:80330 ; RRID:Addgene_80330) -
For your References section:
GoldyTALEN Vectors with Improved Efficiency for Golden Gate TALEN Assembly. Welker JM, Wierson WA, Wang Y, Poshusta TL, McNulty MS, Tisdale EE, Solin SL, Ekker SC, Clark KJ, McGrail M, Essner JJ. Hum Gene Ther. 2016 Jun;27(6):423-4. doi: 10.1089/hum.2016.012. Epub 2016 May 6. 10.1089/hum.2016.012 PubMed 27094430