Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected]. Learn more

Addgene

pKT3Ts-goldyTALEN
(Plasmid #80330)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 80330 Standard format: Plasmid sent in bacteria as agar stab 1 $85

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pK-SV40AX2woSV40
  • Backbone size (bp) 3863
  • Modifications to backbone
    Base pair mutation T>C at position 438 of the Kan resistance gene to silence an unwanted EspI restriction site. Suggested linearization site is SpeI.
  • Vector type
    Bacterial Expression, TALEN
  • Promoter T3
  • Selectable markers
    LacZ

Growth in Bacteria

  • Bacterial Resistance(s)
    Kanamycin, 50 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ sequencing primer ttggcgtcggcaaacagtgg
  • 3′ sequencing primer Ggcgacgaggtggtcgttgg
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pKT3Ts-goldyTALEN was a gift from Jeffrey Essner (Addgene plasmid # 80330 ; http://n2t.net/addgene:80330 ; RRID:Addgene_80330)
  • For your References section:

    GoldyTALEN Vectors with Improved Efficiency for Golden Gate TALEN Assembly. Welker JM, Wierson WA, Wang Y, Poshusta TL, McNulty MS, Tisdale EE, Solin SL, Ekker SC, Clark KJ, McGrail M, Essner JJ. Hum Gene Ther. 2016 Jun;27(6):423-4. doi: 10.1089/hum.2016.012. Epub 2016 May 6. 10.1089/hum.2016.012 PubMed 27094430