-
PurposeExpresses Tandem Dimer smURFP and Heme Oxygenase-1 in bacterial cells.
-
Depositing Labs
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80342 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepBAD
-
Backbone manufacturerLife Technlogies
- Backbone size w/o insert (bp) 4740
- Total vector size (bp) 5628
-
Modifications to backboneContains Ribosomal Binding Site for expression of both TDsmURFP and HO-1.
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsFor smURFP and HO-1 expression, arabinose is required.
-
Copy numberHigh Copy
Gene/Insert 1
-
Gene/Insert nameTandem Dimer smURFP
-
Alt nameTandem Dimer small Ultra-Red Fluorescent Protein
-
SpeciesSynthetic
-
Insert Size (bp)888
-
GenBank IDKX449135
- Promoter pBAD
-
Tag
/ Fusion Protein
- 6 Histidine Tag (C terminal on backbone)
Cloning Information for Gene/Insert 1
- Cloning method Restriction Enzyme
- 5′ cloning site BamHI (not destroyed)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer ATGCCATAGCATTTTTATCC
- 3′ sequencing primer CCCatgagtgtcaacttagcttccc
- (Common Sequencing Primers)
Gene/Insert 2
-
Gene/Insert nameHO-1
-
Alt nameHeme Oxygenase-1
-
SpeciesSynechocystis
- Promoter pBAD
Cloning Information for Gene/Insert 2
- Cloning method Unknown
- 5′ sequencing primer GGCTATGTCCGAATTCCATCATC
- 3′ sequencing primer GATTTAATCTGTATCAGG
- (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byAll constructs with HO-1 was initially obtained from Professor J. Clark Lagarias (University of California, Davis).
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pBAD-TDsmURFP-RBS-HO-1 was a gift from Erik Rodriguez & Roger Tsien (Addgene plasmid # 80342 ; http://n2t.net/addgene:80342 ; RRID:Addgene_80342) -
For your References section:
A far-red fluorescent protein evolved from a cyanobacterial phycobiliprotein. Rodriguez EA, Tran GN, Gross LA, Crisp JL, Shu X, Lin JY, Tsien RY. Nat Methods. 2016 Aug 1. doi: 10.1038/nmeth.3935. 10.1038/nmeth.3935 PubMed 27479328