pLenti6-DCX-EGFP
(Plasmid
#80599)
-
PurposepLenti6 destination vector encoding C-terminally EGFP-tagged human doublecortin (DCX; GenBank: NM_178152)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80599 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepLenti6/V5-DEST
-
Backbone manufacturerInvitrogen
- Backbone size w/o insert (bp) 8500
- Total vector size (bp) 9019
-
Vector typeLentiviral
-
Selectable markersBlasticidin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)Stbl3
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameDoublecortin
-
Alt nameDCX
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1095
-
GenBank IDNM_178152
-
Entrez GeneDCX (a.k.a. DBCN, DC, LISX, SCLH, XLIS)
- Promoter CMV
-
Tag
/ Fusion Protein
- EGFP (C terminal on insert)
Cloning Information
- Cloning method Gateway Cloning
- 5′ sequencing primer CMV forward (CGCAAATGGGCGGTAGGCGTG)
- 3′ sequencing primer EGFP N reverse (cgtcgccgtccagctcgaccag) (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made byThe original DCX sequence comes from Addgene Plasmid #32851
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLenti6-DCX-EGFP was a gift from Torsten Wittmann (Addgene plasmid # 80599 ; http://n2t.net/addgene:80599 ; RRID:Addgene_80599) -
For your References section:
Doublecortin Is Excluded from Growing Microtubule Ends and Recognizes the GDP-Microtubule Lattice. Ettinger A, van Haren J, Ribeiro SA, Wittmann T. Curr Biol. 2016 Jun 20;26(12):1549-55. doi: 10.1016/j.cub.2016.04.020. Epub 2016 May 26. 10.1016/j.cub.2016.04.020 PubMed 27238282