TR-Csy4-H29A
(Plasmid
#80602)
-
PurposeExpresses Csy4 with an inactivating H29A mutation from the CBA promoter. Cloned into an Adeno-Associated Virus backbone for packaging into AAV.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80602 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Want a viral vector made from this plasmid?
Make a packaging request and we'll get back to you.
Please log in to submit a packaging request.
-
SerotypeSelect serotype for details See details about
-
PricingSelect serotype and quantity $ USD for preparation of µL virus + $32 USD for plasmid.
-
How this works
- Place a request for a quantity of 2 (0.2 mL), 10 (1 mL), 25 (2.5 mL), or 50 (5 mL). Our all-inclusive pricing includes DNA production and QC.
- Addgene will quickly confirm that we can produce a high-quality prep for you.
- Track your request and place an order from within your account. Payment information must be added before we can begin processing your order.
- Receive your prep in 6–9 weeks after the MTA is approved by your organization.
- Learn more about our Packaged on Request Service.
Backbone
-
Vector backboneAAV ITR backbone
- Backbone size w/o insert (bp) 5077
- Total vector size (bp) 5641
-
Vector typeMammalian Expression, AAV
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameCsy4-H29A
-
Alt nameCas6f
-
SpeciesPseudomonas aeruginosa
-
Insert Size (bp)564
-
MutationHis29 mutated to Ala
- Promoter CBA
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site XbaI (not destroyed)
- 3′ cloning site NotI (not destroyed)
- 5′ sequencing primer caaatctgtgcggagccgaaatctgggagg
- (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
TR-Csy4-H29A was a gift from Aravind Asokan (Addgene plasmid # 80602 ; http://n2t.net/addgene:80602 ; RRID:Addgene_80602) -
For your References section:
Controlling mRNA stability and translation with the CRISPR endoribonuclease Csy4. Borchardt EK, Vandoros LA, Huang M, Lackey PE, Marzluff WF, Asokan A. RNA. 2015 Nov;21(11):1921-30. doi: 10.1261/rna.051227.115. Epub 2015 Sep 9. 10.1261/rna.051227.115 PubMed 26354771