Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

(Plasmid #80615)


Item Catalog # Description Quantity Price (USD)
Plasmid 80615 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.


  • Vector backbone
  • Backbone size (bp) 5915
  • Vector type
    Insect Expression
  • Selectable markers

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin and Spectinomycin
  • Growth Temperature
  • Growth Strain(s)
  • Copy number

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
  • 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC
  • (Common Sequencing Primers)

Resource Information

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBIG1e was a gift from Jan-Michael Peters (Addgene plasmid # 80615 ; ; RRID:Addgene_80615)
  • For your References section:

    biGBac enables rapid gene assembly for the expression of large multisubunit protein complexes. Weissmann F, Petzold G, VanderLinden R, Huis In 't Veld PJ, Brown NG, Lampert F, Westermann S, Stark H, Schulman BA, Peters JM. Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2564-9. doi: 10.1073/pnas.1604935113. Epub 2016 Apr 25. 10.1073/pnas.1604935113 PubMed 27114506