Skip to main content

pBIG2ab
(Plasmid #80616)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 80616 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pBIG2ab
  • Backbone size (bp) 5668
  • Vector type
    Insect Expression
  • Selectable markers
    Gentamicin

Growth in Bacteria

  • Bacterial Resistance(s)
    Chloramphenicol and Ampicillin, 25 & 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    Unknown

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer TCAACAGGTTGAACTGCTGATC
  • 3′ sequencing primer GGTGTAGCGTCGTAAGCTAATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pBIG2ab was a gift from Jan-Michael Peters (Addgene plasmid # 80616 ; http://n2t.net/addgene:80616 ; RRID:Addgene_80616)
  • For your References section:

    biGBac enables rapid gene assembly for the expression of large multisubunit protein complexes. Weissmann F, Petzold G, VanderLinden R, Huis In 't Veld PJ, Brown NG, Lampert F, Westermann S, Stark H, Schulman BA, Peters JM. Proc Natl Acad Sci U S A. 2016 May 10;113(19):E2564-9. doi: 10.1073/pnas.1604935113. Epub 2016 Apr 25. 10.1073/pnas.1604935113 PubMed 27114506
Included in kit:
Commonly requested with: