-
Purposemammalian expression N-term FLAG and C-term mCherry hPPP1R15B (CReP 4-713)
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 80707 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonemCherry_N3
-
Backbone manufacturerclonetech
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Kanamycin, 50 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert namehuman PPP1R15B
-
Alt nameCReP
-
SpeciesH. sapiens (human)
-
Insert Size (bp)2145
-
MutationCDS 4-713 no stop codon
-
Entrez GenePPP1R15B (a.k.a. CREP, MSSGM2)
- Promoter CMV
-
Tag
/ Fusion Protein
- mCherry (C terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site HindIII (not destroyed)
- 3′ cloning site BglII into BamHI (destroyed during cloning)
- 5′ sequencing primer CGCAAATGGGCGGTAGGCGTG
- 3′ sequencing primer TGCACCTTGAAGCGCATGAACTC
- (Common Sequencing Primers)
Resource Information
-
Supplemental Documents
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG_hPPP1R15B_4-713_mCherry_UK1298 was a gift from David Ron (Addgene plasmid # 80707 ; http://n2t.net/addgene:80707 ; RRID:Addgene_80707) -
For your References section:
G-actin provides substrate-specificity to eukaryotic initiation factor 2alpha holophosphatases. Chen R, Rato C, Yan Y, Crespillo-Casado A, Clarke HJ, Harding HP, Marciniak SJ, Read RJ, Ron D. Elife. 2015 Mar 16;4. doi: 10.7554/eLife.04871. 10.7554/eLife.04871 PubMed 25774600