-
Purpose(Empty Backbone) All-in-one doxycycline inducible lentiviral vector for expression of one or two genes using the P2A self-cleaving peptide.
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 80923 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepCW57.1
-
Backbone manufacturerBroad Insitute
- Backbone size (bp) 7834
-
Modifications to backbonepCW57-MCS1-2A-MCS2 was modified by replacing puromycin with turbo RFP.
-
Vector typeMammalian Expression, Lentiviral ; Doxycycline inducible; P2A Self Cleaving Peptide; Turbo RFP reporter
- Promoter TRE
-
Selectable markersRFP
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberUnknown
Cloning Information
- Cloning method Restriction Enzyme
- 5′ sequencing primer pCW57.MCS_Seq_F CGTATGTCGAGGTAGGCGTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pCW57-MCS1-P2A-MCS2 (RFP) was a gift from Adam Karpf (Addgene plasmid # 80923 ; http://n2t.net/addgene:80923 ; RRID:Addgene_80923) -
For your References section:
Pan-Cancer Analyses Reveal Genomic Features of FOXM1 Overexpression in Cancer. Barger CJ, Branick C, Chee L, Karpf AR. Cancers (Basel). 2019 Feb 21;11(2). pii: cancers11020251. doi: 10.3390/cancers11020251. 10.3390/cancers11020251 PubMed 30795624