pEN_TmiRc3_shURB5
(Plasmid
#81066)
-
PurposeGateway entry vector encoding shRNA to UBR5
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 81066 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $85 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepEN_TmiRc3 (pENTR1A-Gent)
-
Backbone manufacturerATCC 10326362
- Backbone size w/o insert (bp) 4232
- Total vector size (bp) 4295
-
Vector typeCloning
Growth in Bacteria
-
Bacterial Resistance(s)Gentamicin, 10 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameshRNA targeting UBR5
-
gRNA/shRNA sequenceCGCAGTGAATGTAGATTCCAAA
-
SpeciesSynthetic
- Promoter N/A
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site BfuA1 (unknown if destroyed)
- 3′ cloning site BfuA1 (unknown if destroyed)
- 5′ sequencing primer Unknown
- 3′ sequencing primer Unknown (Common Sequencing Primers)
Resource Information
-
A portion of this plasmid was derived from a plasmid made bypEN_TmiRc3 was a gift from Iain Fraser (Addgene plasmid # 25748)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
For use with pSLIK lentiviral system. Original publication:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103
shRNA sequence obtained from the RNAi Codex:
A. Olson, N. Sheth, J. S. Lee, G. Hannon and R. Sachidanandam (2005) RNAi Codex: a portal/database for short-hairpin RNA (shRNA) gene-silencing constructs. Nucleic Acids Research, 34, D153-D157
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pEN_TmiRc3_shURB5 was a gift from Darren Saunders (Addgene plasmid # 81066 ; http://n2t.net/addgene:81066 ; RRID:Addgene_81066) -
For your References section:
The E3 ubiquitin ligase UBR5 regulates centriolar satellite stability and primary cilia. Shearer RF, Frikstad KM, McKenna J, McCloy RA, Deng N, Burgess A, Stokke T, Patzke S, Saunders DN. Mol Biol Cell. 2018 May 9:mbcE17040248. doi: 10.1091/mbc.E17-04-0248. 10.1091/mbc.E17-04-0248 PubMed 29742019