pEN_TmiRc3_shNT
(Plasmid #81067)

• Purpose: Gateway entry vector encoding non-targeting shRNA
• Depositing Lab: Darren Saunders
• Publication: Shearer et al Mol Biol Cell. 2018 May 9:mbcE17040248. doi: 10.1091/mbc.E17-04-0248.

Backbone

• Vector backbone: pEN_TmiRc3 (pENTR1A-Gent)
• Backbone manufacturer: ATCC 10326362
• Backbone size w/o insert (bp): 4232
• Total vector size (bp): 4297
• Vector type: Cloning

Growth in Bacteria

• Bacterial Resistance(s): Gentamicin, 10 μg/mL
• Growth Temperature: 37°C
• Growth Strain(s): DH5alpha
• Copy number: High Copy

Gene/Insert

• Gene/Insert name: non-targeting shRNA
• gRNA/shRNA sequence: TCGATGCTCTAAGGTTCTATC
• Species: Synthetic
• Promoter: N/A

Cloning Information

• Cloning method: Restriction Enzyme
• 5′ cloning site: BfuA1 (unknown if destroyed)
• 3′ cloning site: BfuA1 (unknown if destroyed)
• 5′ sequencing primer: Unknown
• 3′ sequencing primer: Unknown

Resource Information

• A portion of this plasmid was derived from a plasmid made by: pEN_TmiRc3 was a gift from Iain Fraser (Addgene plasmid # 25748)

Terms and Licenses

• Academic/Nonprofit Terms:
  • UBMTA
• Industry Terms:
  • Not Available to Industry

Depositor Comments

For use with pSLIK lentiviral system. Original publication:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103