Skip to main content

pEN_TmiRc3_shNT
(Plasmid #81067)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 81067 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pEN_TmiRc3 (pENTR1A-Gent)
  • Backbone manufacturer
    ATCC 10326362
  • Backbone size w/o insert (bp) 4232
  • Total vector size (bp) 4297
  • Vector type
    Cloning

Growth in Bacteria

  • Bacterial Resistance(s)
    Gentamicin, 10 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    DH5alpha
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    non-targeting shRNA
  • gRNA/shRNA sequence
    TCGATGCTCTAAGGTTCTATC
  • Species
    Synthetic
  • Promoter N/A

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BfuA1 (unknown if destroyed)
  • 3′ cloning site BfuA1 (unknown if destroyed)
  • 5′ sequencing primer Unknown
  • 3′ sequencing primer Unknown
  • (Common Sequencing Primers)

Resource Information

  • A portion of this plasmid was derived from a plasmid made by
    pEN_TmiRc3 was a gift from Iain Fraser (Addgene plasmid # 25748)

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

For use with pSLIK lentiviral system. Original publication:
A single lentiviral vector platform for microRNA-based conditional RNA interference and coordinated transgene expression. Shin KJ, Wall EA, Zavzavadjian JR, Santat LA, Liu J, Hwang JI, Rebres R, Roach T, Seaman W, Simon MI, Fraser ID. Proc Natl Acad Sci U S A. 2006 Sep 12. 103(37):13759-64. 10.1073/pnas.0606179103

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pEN_TmiRc3_shNT was a gift from Darren Saunders (Addgene plasmid # 81067 ; http://n2t.net/addgene:81067 ; RRID:Addgene_81067)
  • For your References section:

    The E3 ubiquitin ligase UBR5 regulates centriolar satellite stability and primary cilia. Shearer RF, Frikstad KM, McKenna J, McCloy RA, Deng N, Burgess A, Stokke T, Patzke S, Saunders DN. Mol Biol Cell. 2018 May 9:mbcE17040248. doi: 10.1091/mbc.E17-04-0248. 10.1091/mbc.E17-04-0248 PubMed 29742019