FLAG-KLF12/pcDNA3.1-Neo
(Plasmid
#81069)
-
PurposeExpression of epitope-tagged human KLF12 in mammalian cells.
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 81069 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepcDNA3
-
Vector typeMammalian Expression
-
Selectable markersNeomycin (select with G418)
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameFLAG-KLF12
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1300
-
Entrez GeneKLF12 (a.k.a. AP-2rep, AP2REP, HSPC122)
-
Tag
/ Fusion Protein
- FLAG (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoRI (unknown if destroyed)
- 3′ cloning site EcoRI (unknown if destroyed)
- 5′ sequencing primer tgagtcatgttcaccgcatc
- 3′ sequencing primer tgttgcatccctcaaaatca (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
FLAG-KLF12/pcDNA3.1-Neo was a gift from Julian Downward (Addgene plasmid # 81069 ; http://n2t.net/addgene:81069 ; RRID:Addgene_81069) -
For your References section:
Tumour-suppression function of KLF12 through regulation of anoikis. Godin-Heymann N, Brabetz S, Murillo MM, Saponaro M, Santos CR, Lobley A, East P, Chakravarty P, Matthews N, Kelly G, Jordan S, Castellano E, Downward J. Oncogene. 2016 Jun 23;35(25):3324-34. doi: 10.1038/onc.2015.394. Epub 2015 Oct 12. 10.1038/onc.2015.394 PubMed 26455320