pACSA_PcptOO_C38T,A39T_YFP_PMB2_LacIWF
(Plasmid
#82021)
-
PurposecLac143; pALM143; IPTG inducible system
-
Depositing Lab
-
Sequence Information
Ordering
| Item | Catalog # | Description | Quantity | Price (USD) | |
|---|---|---|---|---|---|
| Plasmid | 82021 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 | |
Backbone
-
Vector backbonepACSA
- Total vector size (bp) 6373
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)DH5alpha
-
Copy numberUnknown
Gene/Insert
-
Gene/Insert nameYFP
- Promoter Pcptoo_C38T,A39T
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCTTCCGGCTCGTATGTTGTG
- 3′ sequencing primer TTGGGTAACGCCAGGGT
- (Common Sequencing Primers)
Resource Information
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pACSA_PcptOO_C38T,A39T_YFP_PMB2_LacIWF was a gift from Brian Pfleger (Addgene plasmid # 82021 ; http://n2t.net/addgene:82021 ; RRID:Addgene_82021) -
For your References section:
Synthetic biology toolbox for controlling gene expression in the cyanobacterium Synechococcus sp. strain PCC 7002. Markley AL, Begemann MB, Clarke RE, Gordon GC, Pfleger BF. ACS Synth Biol. 2015 May 15;4(5):595-603. doi: 10.1021/sb500260k. Epub 2014 Sep 25. 10.1021/sb500260k PubMed 25216157