-
Purposeused to silence target human FASN expression via RNA interference (3rd gen lentiviral vector)
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82327 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepLKO.1
- Backbone size w/o insert (bp) 7085
-
Vector typeMammalian Expression, Lentiviral, RNAi
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberLow Copy
Gene/Insert
-
Gene/Insert nameshRNA to target Fatty Acid Synthase (FASN)
-
gRNA/shRNA sequenceCacaccggtcgagagcacctttgatgacatctcgagatgtcatcaaaggtgctctcgtttttgaattccat
-
SpeciesH. sapiens (human)
-
GenBank IDAY451392
-
Entrez GeneFASN (a.k.a. FAS, OA-519, SDR27X1)
- Promoter U6
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site AgeI (destroyed during cloning)
- 3′ cloning site EcoRI (not destroyed)
- 5′ sequencing primer LKO.1 5'
- 3′ sequencing primer GGACTATCATATGCTTACCGTAACTTG (Common Sequencing Primers)
Resource Information
-
Articles Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
Depositor Comments
This plasmid was created from Addgene scramble shRNA Plasmid #1864
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pLKO.1 puro-humanU6-shRNA FASN was a gift from Elizabeth Stoll (Addgene plasmid # 82327 ; http://n2t.net/addgene:82327 ; RRID:Addgene_82327)