Skip to main content

pGLO-GFP-1UAG
(Plasmid #82500)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82500 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pGLO
  • Backbone manufacturer
    Bio-Rad
  • Backbone size w/o insert (bp) 4651
  • Total vector size (bp) 5374
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The SS320 strain was used in the associated publication.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Green Fluorescent Protein with 1 UAG codon
  • Alt name
    GFP-1UAG
  • Species
    Synthetic
  • Insert Size (bp)
    723
  • Mutation
    Added an UAG codon at the amino acid position 3
  • Promoter AraBAD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCATTCTGTAACAAAGCGGG
  • 3′ sequencing primer CTGATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGLO-GFP-1UAG was a gift from Chang Liu (Addgene plasmid # 82500 ; http://n2t.net/addgene:82500 ; RRID:Addgene_82500)
  • For your References section:

    A second-generation expression system for tyrosine-sulfated proteins and its application in crop protection. Schwessinger B, Li X, Ellinghaus TL, Chan LJ, Wei T, Joe A, Thomas N, Pruitt R, Adams PD, Chern MS, Petzold CJ, Liu CC, Ronald PC. Integr Biol (Camb). 2016 Apr 18;8(4):542-5. doi: 10.1039/c5ib00232j. Epub 2015 Nov 27. 10.1039/c5ib00232j PubMed 26611838