pGLO-GFP-3UAG
(Plasmid
#82501)
-
PurposeExpresses GFP with 3 UAG codons at the amino acid position 3, 151, and 153
-
Depositing Lab
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82501 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $75 |
This material is available to academics and nonprofits only.
Backbone
-
Vector backbonepGLO
-
Backbone manufacturerBio-Rad
- Backbone size w/o insert (bp) 4651
- Total vector size (bp) 5374
-
Vector typeBacterial Expression
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature30°C
-
Growth Strain(s)DH5alpha
-
Growth instructionsThe SS320 strain was used in the associated publication.
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameGreen Fluorescence Protein with 3 UAG codons
-
Alt nameGFP-3UAG
-
SpeciesAequorea victoria
-
Insert Size (bp)723
-
MutationAdded an UAG codon at the amino acid position 3, changed asparagine at position 151 and tyrosine at position 153 to an UAG codon
- Promoter AraBAD
Cloning Information
- Cloning method Gibson Cloning
- 5′ sequencing primer GCATTCTGTAACAAAGCGGG
- 3′ sequencing primer CTGATTTAATCTGTATCAGG (Common Sequencing Primers)
Resource Information
-
Article Citing this Plasmid
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pGLO-GFP-3UAG was a gift from Chang Liu (Addgene plasmid # 82501 ; http://n2t.net/addgene:82501 ; RRID:Addgene_82501) -
For your References section:
A second-generation expression system for tyrosine-sulfated proteins and its application in crop protection. Schwessinger B, Li X, Ellinghaus TL, Chan LJ, Wei T, Joe A, Thomas N, Pruitt R, Adams PD, Chern MS, Petzold CJ, Liu CC, Ronald PC. Integr Biol (Camb). 2016 Apr 18;8(4):542-5. doi: 10.1039/c5ib00232j. Epub 2015 Nov 27. 10.1039/c5ib00232j PubMed 26611838