Skip to main content
This website uses cookies to ensure you get the best experience. By continuing to use this site, you agree to the use of cookies.
We will increase some of our prices at 12:00 AM ET on April 1, 2023. Be sure to complete your order before this time to take advantage of current prices. See the new prices and get more information or speak with our friendly support team.

Please note: Your browser does not support the features used on Addgene's website. You may not be able to create an account or request plasmids through this website until you upgrade your browser. Learn more

Please note: Your browser does not fully support some of the features used on Addgene's website. If you run into any problems registering, depositing, or ordering please contact us at [email protected] Learn more

pGLO-GFP-3UAG
(Plasmid #82501)

Ordering

Item Catalog # Description Quantity Price (USD)
Plasmid 82501 Standard format: Plasmid sent in bacteria as agar stab 1 $75

This material is available to academics and nonprofits only.

Backbone

  • Vector backbone
    pGLO
  • Backbone manufacturer
    Bio-Rad
  • Backbone size w/o insert (bp) 4651
  • Total vector size (bp) 5374
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    30°C
  • Growth Strain(s)
    DH5alpha
  • Growth instructions
    The SS320 strain was used in the associated publication.
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Green Fluorescence Protein with 3 UAG codons
  • Alt name
    GFP-3UAG
  • Species
    Aequorea victoria
  • Insert Size (bp)
    723
  • Mutation
    Added an UAG codon at the amino acid position 3, changed asparagine at position 151 and tyrosine at position 153 to an UAG codon
  • Promoter AraBAD

Cloning Information

  • Cloning method Gibson Cloning
  • 5′ sequencing primer GCATTCTGTAACAAAGCGGG
  • 3′ sequencing primer CTGATTTAATCTGTATCAGG
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pGLO-GFP-3UAG was a gift from Chang Liu (Addgene plasmid # 82501 ; http://n2t.net/addgene:82501 ; RRID:Addgene_82501)
  • For your References section:

    A second-generation expression system for tyrosine-sulfated proteins and its application in crop protection. Schwessinger B, Li X, Ellinghaus TL, Chan LJ, Wei T, Joe A, Thomas N, Pruitt R, Adams PD, Chern MS, Petzold CJ, Liu CC, Ronald PC. Integr Biol (Camb). 2016 Apr 18;8(4):542-5. doi: 10.1039/c5ib00232j. Epub 2015 Nov 27. 10.1039/c5ib00232j PubMed 26611838