-
PurposeExpresses Halotag-Cbx2 fusion proteins in mammalian cells
-
Depositing Lab
-
Publication
-
Sequence Information
Ordering
Item | Catalog # | Description | Quantity | Price (USD) | |
---|---|---|---|---|---|
Plasmid | 82510 | Standard format: Plasmid sent in bacteria as agar stab | 1 | $89 |
Backbone
-
Vector backbonepTRIPZ (M)
- Backbone size w/o insert (bp) 12257
- Total vector size (bp) 14757
-
Vector typeMammalian Expression, Lentiviral
-
Selectable markersPuromycin
Growth in Bacteria
-
Bacterial Resistance(s)Ampicillin, 100 μg/mL
-
Growth Temperature37°C
-
Growth Strain(s)NEB Stable
-
Copy numberHigh Copy
Gene/Insert
-
Gene/Insert nameChromobox Homolog 2
-
Alt nameCbx2
-
SpeciesH. sapiens (human)
-
Insert Size (bp)1608
-
GenBank IDNM_005189
-
Entrez GeneCBX2 (a.k.a. CDCA6, M33, SRXY5)
- Promoter aggcgtgtacggtgggaggcctatataagcagagctcgtttagtgaaccgtcagatcg
-
Tag
/ Fusion Protein
- HaloTag (N terminal on insert)
Cloning Information
- Cloning method Restriction Enzyme
- 5′ cloning site EcoR1 (unknown if destroyed)
- 3′ cloning site Mlu1 (unknown if destroyed)
- 5′ sequencing primer cgtgtacggtgggaggcctatataa
- 3′ sequencing primer cccccctcctcacggcgagcgctgc (Common Sequencing Primers)
Terms and Licenses
-
Academic/Nonprofit Terms
-
Industry Terms
- Not Available to Industry
Trademarks:
- Zeocin® is an InvivoGen trademark.
These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.
-
For your Materials & Methods section:
pTRIPZ (M)-HT-Cbx2 was a gift from Xiaojun Ren (Addgene plasmid # 82510 ; http://n2t.net/addgene:82510 ; RRID:Addgene_82510)