Skip to main content

pTRIPZ (M)-HT-Cbx4
(Plasmid #82513)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82513 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pTRIPZ (M)
  • Backbone size w/o insert (bp) 12300
  • Total vector size (bp) 14802
  • Vector type
    Mammalian Expression, Lentiviral
  • Selectable markers
    Puromycin

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Chromobox Homolog 4
  • Alt name
    Cbx4
  • Species
    M. musculus (mouse)
  • Insert Size (bp)
    1683
  • GenBank ID
    NM_003655
  • Entrez Gene
    Cbx4 (a.k.a. MPc, MPc2, PC, PC2)
  • Promoter cmv
  • Tag / Fusion Protein
    • HaloTag (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site EcoR1 (unknown if destroyed)
  • 3′ cloning site Mlu1 (unknown if destroyed)
  • 5′ sequencing primer CTCGCTGCCGATCAGGTCCGGGTTG
  • 3′ sequencing primer gcgcccccctcctcacggcgagcgc
  • (Common Sequencing Primers)

Terms and Licenses

Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    pTRIPZ (M)-HT-Cbx4 was a gift from Xiaojun Ren (Addgene plasmid # 82513 ; http://n2t.net/addgene:82513 ; RRID:Addgene_82513)