Skip to main content

FSW-HRP-V5-LRRTM2
(Plasmid #82537)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82537 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    FSW
  • Backbone size w/o insert (bp) 9543
  • Total vector size (bp) 10995
  • Vector type
    Mammalian Expression, Lentiviral

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    Unknown

Gene/Insert

  • Gene/Insert name
    LRRTM2
  • Species
    H. sapiens (human)
  • Insert Size (bp)
    1452
  • Entrez Gene
    LRRTM2
  • Promoter Human Synapsin
  • Tags / Fusion Proteins
    • HRP (N terminal on insert)
    • V5 (N terminal on insert)

Cloning Information

  • Cloning method Restriction Enzyme
  • 5′ cloning site BamHI (not destroyed)
  • 3′ cloning site AscI (not destroyed)
  • 5′ sequencing primer GCGCTGCGGCGCCGGCGACTCAGC
  • 3′ sequencing primer gcgtaaaaggagcaacatagttaagaataccagtcaatc
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.
How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    FSW-HRP-V5-LRRTM2 was a gift from Alice Ting (Addgene plasmid # 82537 ; http://n2t.net/addgene:82537 ; RRID:Addgene_82537)
  • For your References section:

    Proteomic Analysis of Unbounded Cellular Compartments: Synaptic Clefts. Loh KH, Stawski PS, Draycott AS, Udeshi ND, Lehrman EK, Wilton DK, Svinkina T, Deerinck TJ, Ellisman MH, Stevens B, Carr SA, Ting AY. Cell. 2016 Aug 25;166(5):1295-1307.e21. doi: 10.1016/j.cell.2016.07.041. 10.1016/j.cell.2016.07.041 PubMed 27565350