Skip to main content

bbCas9pluspAAA
(Plasmid #82581)

Ordering

This material is available to academics and nonprofits only.
Item Catalog # Description Quantity Price (USD)
Plasmid 82581 Standard format: Plasmid sent in bacteria as agar stab 1 $89

Backbone

  • Vector backbone
    pUC
  • Backbone size w/o insert (bp) 1932
  • Total vector size (bp) 6397
  • Vector type
    Bacterial Expression

Growth in Bacteria

  • Bacterial Resistance(s)
    Ampicillin, 100 μg/mL
  • Growth Temperature
    37°C
  • Growth Strain(s)
    NEB Stable
  • Copy number
    High Copy

Gene/Insert

  • Gene/Insert name
    Cas9
  • Alt name
    humanized Cas9
  • Species
    S. pyogenes
  • Promoter T7

Cloning Information

  • Cloning method Unknown
  • 5′ sequencing primer CTGCGTTATCCCCTGATTCTGTGG
  • 3′ sequencing primer GGGCGACACGGAAATGTTGAATAC
  • (Common Sequencing Primers)

Resource Information

Terms and Licenses

  • Academic/Nonprofit Terms
  • Industry Terms
    • Not Available to Industry
Trademarks:
  • Zeocin® is an InvivoGen trademark.

Depositor Comments

Cas9 insert is cloned from pX330 Addgene #42230

How to cite this plasmid ( Back to top)

These plasmids were created by your colleagues. Please acknowledge the Principal Investigator, cite the article in which the plasmids were described, and include Addgene in the Materials and Methods of your future publications.

  • For your Materials & Methods section:

    bbCas9pluspAAA was a gift from Ivo Huijbers (Addgene plasmid # 82581 ; http://n2t.net/addgene:82581 ; RRID:Addgene_82581)
  • For your References section:

    Direct Generation of Conditional Alleles Using CRISPR/Cas9 in Mouse Zygotes. Pritchard CEJ, Kroese LJ, Huijbers IJ. Methods Mol Biol. 2017;1642:21-35. doi: 10.1007/978-1-4939-7169-5_2. 10.1007/978-1-4939-7169-5_2 PubMed 28815491